Difference between revisions of "Biopython/C2/Introduction-to-Biopython/English"

Title Slide

Learning Objectives

• Important features of Biopython.
• Information regarding download and installation on Linux Operating System.
• And translation of a DNA sequence to a protein sequence using Biopython tools.

Pre-requisites

• Undergraduate Biochemistry or Bioinformatics
• And basic Python programming

Refer to the Python tutorials at the given link.

System Requirement

• Ubuntu OS version 12.04
• Python version 2.7.3
• Ipython version 0.12.1
• Biopython version 1.58

About Biopython

It can perform most basic to advanced tasks required for bioinformatics.

Biopython functionality

1. Parsing that is extracting information from various file formats such as FASTA, Genbank etc.

2. Download data from database websites such as NCBI, ExPASY etc

3. Run Bioinformatic algorithms such as BLAST

Biopython functionality

For example to obtain complements, transcription, translation etc.

5. Code for dealing with alignments.

6. And code to split up tasks into separate processes.

Download

Biopython package is not part of the Python distribution.

It needs to be downloaded independently.

For details refer the following link

http://biopython.org/wiki/Download

Installation for Ubuntu/Linux systems

• Install Python, Ipython and Biopython packages using Synaptic Package Manager.

• Prerequisite software will be installed automatically.

• Additional packages must be installed for graphic outputs and plots.

• Open the terminal by pressing Ctrl, Alt and T keys simultaneously.

Start Ipython interpreter by typing ipython and press Enter.

IPython prompt appears on screen.

Press Enter.

If you don't get any error message, it means Biopython is installed.

Here let me remind you, Python language is case sensitive.

Take precaution while typing keywords, variables or functions.

For instance, in the above line “i” in import is lowercase.

And “B” is uppercase in Bio.

DNA Translation

1. First create a sequence object for coding DNA strand.
2. Next transcription of coding DNA strand to mRNA.
3. Finally translation of mRNA to a protein sequence.

Sequence Object

It codes for a small protein sequence.

The first step is to create a sequence object for the above coding DNA strand.

Let us go back to the terminal.

Type:

>>> from Bio.Seq import Seq

The Seq module provides methods to store and process sequence objects.

At the prompt, type from Bio dot Seq import Seq

press Enter.

That is to specify whether the sequence of alphabets code for nucleotides or amino acids.

At the prompt, type:

from Bio dot Alphabet import IUPAC

Press Enter.

Note that, we have used import and from statements to load Seq and IUPAC modules.

Press enter

cdna

press enter

Out put

Seq(ATGTTACACTCCCGATGA”, IUPAC unambiguousDNA())

At the prompt, type: cdna equal to Seq as in normal strings.

Enclose the sequence within double quotes and parentheses.

We know our sequence is a DNA fragment.

So, type: unambiguous DNA alphabet object as an argument.

For the output type: cdna; press Enter

The output shows the DNA sequence as a sequence object.

We will use the Seq module's built-in “transcribe” method.

>>> mrna = coding_dna.transcribe()

press enter

Type

mrna press enter

>>> mrna

Seq('AUGUUACACUCCCGAUGA', IUPACUnambiguousRNA())

Store the output in a variable mrna.

At the prompt type,

mrna equal to cdna dot transcribe open and close parentheses

press Enter.

For the output, type mrna

press Enter.

The transcribe method replaces the Thiamin in the DNA sequence by Uracil.

>>> mrna.translate()

press enter

Cursor on the terminal.

Output:

protein

Seq('MLHSR*', HasStopCodon(IUPACProtein(), '*'))

protein equal to mrna dot translate open and close parentheses

press Enter.

The translate method translates RNA or DNA sequence using the standard genetic code, if unspecified.

Output:

protein

Seq('MLHSR*', HasStopCodon(IUPACProtein(), '*'))

The output also shows information regarding the presence of stop codons in the

translated sequence.

Observe the asterix at the end of the protein sequence.

It indicates the stop codon.

In Biopython, transcribe method works only on coding DNA strand.

However in real biological systems the process of transcription starts with a template strand.

coding_dna = template_dna.reverse_complement()

• convert it to coding strand
• by using reverse complement method, as shown on the terminal.

Summary

In this tutorial we have learnt

• Important features of Biopython.
• Information regarding download and installation on Linux OS.
• Create a sequence object for the given DNA strand.

Summary

• Transcription of the DNA sequence to mRNA.
• Translation of mRNA to protein sequence.

Assignment

• Translate the given DNA sequence into protein sequence.
• 'ATGGCCCTATAGTGTCTAAGCTAG'
• Observe the output.
• The protein sequence has an internal stop codon.
• As it happens in nature, translate the DNA till first in frame stop codon.

Notice that, we have used 'to underscore stop' argument in the translate method.

Notice the output.

The stop codon itself is not translated.

The stop symbol is not included at the end of your protein sequence.

Acknowledgement

If you do not have good bandwidth, you can download and watch it.

For more details, please write to us.

More information on this Mission is available at this link.